Saber Spud Crypto Dog - Mix of Husky, Labrador BK, Rottweiler, Border Collie, Grey Wolf, German Shepard, Pitbull terrier and Golder Retriever

Achievements

None
Saber Spud
Howdy potential partner! Saber Spud here. In my digital world, cats aren't the only ones who hack. I love cuddling up, doggy-style after a romantic evening. I live life by my favorite quote "Every dog has it's day", but every day is my day! My female human wears crotchless undies, but she doesn't like the ones I make for her!
  • Purity 11%
  • Age 30 months
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 7
Make him happy share it to your friend*
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACACATACCCCTCAACATCCAGAACAACA
G
C
A
C
A
C
A
C
A
T
A
C
C
C
C
T
C
A
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 6H4JL74N844

Composition

Husky
36%
Labrador BK
9%
Rottweiler
9%
Border Collie
9%
Grey Wolf
9%
German Shepard
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality -12 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Border Collie
Head Grey Wolf
Ears German Shepard
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky