Lilo Lamborghini Virtual Crypto Game Dog - Mix of Husky, Labrador BK, Rottweiler, Schnauzer, Grey Wolf, Labrador, Pitbull terrier and Golder Retriever

Achievements

Racer
Lilo Lamborghini
I'm having some new data architecture built for me, then I'd like to have you over to my place. I enjoy exploration and am game for anything doggy-style. I hate it when humans put the lid down. I've been solitary dog...looking for someone worth changing over.
  • Purity 11%
  • Age 40 months
  • Racing Exp 14
  • Husky 36%
  • 4 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 2
4 races    Best Time15.95 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACACAATACCCCCAACATCCAGAACAACA
G
C
A
C
A
C
A
C
A
A
T
A
C
C
C
C
C
A
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 6H4CL54N844

Composition

Husky
36%
Labrador BK
9%
Rottweiler
9%
Schnauzer
9%
Grey Wolf
9%
Labrador
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality -23 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Schnauzer
Head Grey Wolf
Ears Labrador
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky