Leroy Lucas Crypto Dog - Mix of Husky, Boxer, Schnauzer, Grey Wolf, Labrador, Pitbull terrier and Golder Retriever

Achievements

Racer
Leroy Lucas
How goes it? I'm Leroy Lucas. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! Hound Dog by Elvis is probably the best song ever written. I hate going to the vet and will do almost anything to avoid it. Those flying monkeys in the Wizard of Oz still scare me!
  • Purity 18%
  • Age 41 months
  • Racing Exp 22
  • Husky 45%
  • 7 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 3
7 races    Best Time14.67 sec
No rank  Racing *** Coins
42.9 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAACACAATACCCCCAACATCCAGAACAACA
A
C
A
A
A
C
A
C
A
A
T
A
C
C
C
C
C
A
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 4G4CL54N844

Composition

Husky
45%
Boxer
9%
Schnauzer
9%
Grey Wolf
9%
Labrador
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality -25 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail Boxer
Legs Husky
Front Legs Schnauzer
Head Grey Wolf
Ears Labrador
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky