Dino Dillon Bitcoin Dog - Mix of Husky, Golder Retriever, Border Collie, Grey Wolf, Corgi, Dachshund and German Shepard

Achievements

None
Dino Dillon
Dino Dillon here. Wanna play? I run with a pack in the data warehouse. My favorite position is doggie style ;) I love the smell of freshly cut grass. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 12%
  • Age 41 months
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGAACATACCCCAGCACAGGAAGATCAACA
A
C
A
A
G
A
A
C
A
T
A
C
C
C
C
A
G
C
A
C
A
G
G
A
A
G
A
T
C
A
A
C
A
Genes: 484JLO4A874

Composition

Husky
36%
Golder Retriever
18%
Border Collie
9%
Grey Wolf
9%
Corgi
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -18 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Husky
Front Legs Border Collie
Head Grey Wolf
Ears Corgi
Snout Husky
Mouth Dachshund
Nose Golder Retriever
Eyes German Shepard
Color Husky