King Hippo Khaleesi Crypto Dog - Mix of Husky, Golder Retriever, Schnauzer, Labrador BK, Corgi and Pitbull terrier

Achievements

None
King Hippo Khaleesi
Suh? How's it goin? I'm King Hippo Khaleesi. I'm going kill that damn Nyan Cat if I can catch it. I hate hiding under the bed during a thunder storm but that's just smart, right? I'm the best at running circle 8's. Fun-loving and playful only need apply.
  • Purity 20%
  • Age 40 months
  • Racing Exp 0
  • Husky 45%
  • 0 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGAACAATAGCAAGCACATCCAGAACAACA
A
C
A
A
G
A
A
C
A
A
T
A
G
C
A
A
G
C
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 484C6O4N844

Composition

Husky
45%
Golder Retriever
18%
Schnauzer
9%
Labrador BK
9%
Corgi
9%
Pitbull terrier
9%

Current Energy

Vitality -30 points
Lunar Effect +16 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Husky
Front Legs Schnauzer
Head Labrador BK
Ears Corgi
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky