Ming Megan Cryptocurrency Dog - Mix of Golder Retriever, Husky, Schnauzer, Labrador BK and Pitbull terrier

Achievements

Racer
Ming Megan
I answer to 'Ming Megan'. I am a guard dog for the data warehouse. I like giving wet kisses. If you have fleas or ticks, don't bother. Sometimes I just have to roll in something dead. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.
  • Purity 26%
  • Age 40 months
  • Racing Exp 1
  • Golder Retriever 45%
  • 1 races
  • Gen 8
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.02 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGAAGAATAGCAAGAAGATCCAGAACAACA
A
C
A
A
G
A
A
G
A
A
T
A
G
C
A
A
G
A
A
G
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 488C688N844

Composition

Golder Retriever
45%
Husky
27%
Schnauzer
9%
Labrador BK
9%
Pitbull terrier
9%

Current Energy

Vitality -32 points
Lunar Effect +12 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Golder Retriever
Front Legs Schnauzer
Head Labrador BK
Ears Golder Retriever
Snout Golder Retriever
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky