Masher Macy Litecoin Game Dog - Mix of Golder Retriever, Grey Wolf, Border Collie, Labrador BK and Husky

Achievements

Racer
Masher Macy
I run with a pack in the data warehouse. My humans say I slobber too much, but hey, I'm just juicy. I hate having to share my food dish... I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 31%
  • Age 41 months
  • Racing Exp 1
  • Golder Retriever 55%
  • 1 races
  • Gen 9
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.30 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGAAGACCCGCAAGAAGAAGAAGAACACCC
T
A
C
A
G
A
A
G
A
C
C
C
G
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
C
A
C
C
C
Genes: J88L688884L

Composition

Golder Retriever
55%
Grey Wolf
18%
Border Collie
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -16 points
Lunar Effect -2 points

Traits Breakdown

Body Border Collie
Tail Golder Retriever
Legs Golder Retriever
Front Legs Grey Wolf
Head Labrador BK
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Husky
Color Grey Wolf