Tuesday Toots Litecoin Game Dog - Mix of Golder Retriever, St. Bernard, Border Collie, Pitbull terrier and Husky

Achievements

Racer
Tuesday Toots
Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I'll eat my vomit and yours too. I love unconditionally.
  • Purity 31%
  • Age 40 months
  • Racing Exp 2
  • Golder Retriever 55%
  • 2 races
  • Gen 10
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time15.97 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGAAGATCCTGAAGAAGAAGAAGAACATGA
T
A
C
A
G
A
A
G
A
T
C
C
T
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
C
A
T
G
A
Genes: J88NB88884B

Composition

Golder Retriever
55%
St. Bernard
18%
Border Collie
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality -26 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Golder Retriever
Legs Golder Retriever
Front Legs Pitbull terrier
Head St. Bernard
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Husky
Color St. Bernard