Pretty Paco Bitcoin Game Dog - Mix of German Shepard, Husky, Boxer, St. Bernard and Labrador

Achievements

Racer
Pretty Paco
Ima cyber dog. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I adore sleeping upside down with my tongue hanging out! Long or short hair works for me, just no baldies please. Air Bud is definitely my favorite movie. What a role model!
  • Purity 29%
  • Age 26 months
  • Racing Exp 1
  • German Shepard 55%
  • 1 races
  • Gen 13
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.37 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAAACTCATCATGACCAACATCATCATCAACA
T
C
A
A
A
C
T
C
A
T
C
A
T
G
A
C
C
A
A
C
A
T
C
A
T
C
A
T
C
A
A
C
A
Genes: 7G77B547774

Composition

German Shepard
55%
Husky
18%
Boxer
9%
St. Bernard
9%
Labrador
9%

Current Energy

Vitality -12 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs German Shepard
Front Legs German Shepard
Head St. Bernard
Ears Labrador
Snout Husky
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Husky

Parents

No Children

Photos