Red Zone Rufus Bitcoin Game Dog - Mix of Corgi, Labrador BK, Rottweiler, Schnauzer, Border Collie, Grey Wolf, Beagle and Boxer

Achievements

Racer
Red Zone Rufus
What's up, pup? Name's Red Zone Rufus. Even living on the internet like I do, too much kibble makes my bandwidth expand. You'll find me walking into my favorite pet store like I own the place. I do, don't I? My humans say I bark too much, but I have a lot to say!
  • Purity 11%
  • Age 41 months
  • Racing Exp 8
  • Corgi 36%
  • 3 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time15.70 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACATATACAGCCCCAGCCTAAGCAGCAAC
G
C
A
C
A
C
A
T
A
T
A
C
A
G
C
C
C
C
A
G
C
C
T
A
A
G
C
A
G
C
A
A
C
Genes: 6HCJOLODOOG

Composition

Corgi
36%
Labrador BK
9%
Rottweiler
9%
Schnauzer
9%
Border Collie
9%
Grey Wolf
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality -37 points
Lunar Effect -2 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Schnauzer
Front Legs Border Collie
Head Corgi
Ears Grey Wolf
Snout Corgi
Mouth Beagle
Nose Corgi
Eyes Corgi
Color Boxer