Lando Laney Crypto Dog - Pure German Shepard

Achievements

None
Lando Laney
Hello, I be Lando Laney. I like exploring off leash best. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! Spiked dog collars really turn me on. I'd like to leave my paw prints in the sand next to yours on a moonlit beach.
  • Purity 100%
  • Age 40 months
  • Racing Exp 0
  • German Shepard 100%
  • 0 races
  • Gen 13
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard