Jelly Jesse Litecoin Game Dog - Mix of German Shepard, Rottweiler, Labrador and Maltese

Achievements

None
Jelly Jesse
I don't like having to stay in the car when my people go inside. I never met a leg I didn't want to hump. Are you into garbage cans? I am. My favorite thing is to sit in my humans' laps while they are trying to read or drive.
  • Purity 52%
  • Age 38 months
  • Racing Exp 0
  • German Shepard 73%
  • 0 races
  • Gen 12
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATCATCATCATCATCACACCCATCATCAACC
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
C
A
C
C
C
A
T
C
A
T
C
A
A
C
C
Genes: 777777H577K

Composition

German Shepard
73%
Rottweiler
9%
Labrador
9%
Maltese
9%

Current Energy

Vitality -5 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout Rottweiler
Mouth Labrador
Nose German Shepard
Eyes German Shepard
Color Maltese