Nightwolf Norma Crypto Dog - Mix of German Shepard, Golder Retriever, Pug, Husky, Schnauzer, Maltese, Labrador, Labrador BK and Rottweiler

Achievements

Podium Champion
Pro Racer
Nightwolf Norma
I live in your digital dreams. I enjoy staying active, and running circles around puppies and young children. I'll lick anything. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I want a mate that knows how to give a proper belly rub!
  • Purity 5%
  • Age 43 months
  • Racing Exp 61
  • German Shepard 18%
  • 12 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

12 races   |
  • 3 3 2
 Best Time14.53 sec
Rank 74  Racing *** Coins
66.7 % wins (8) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAAAGAAGAACATCAATAACCCCAGCACAC
T
C
A
G
A
A
A
G
A
A
G
A
A
C
A
T
C
A
A
T
A
A
C
C
C
C
A
G
C
A
C
A
C
Genes: 728847CK56H

Composition

German Shepard
18%
Golder Retriever
18%
Pug
9%
Husky
9%
Schnauzer
9%
Maltese
9%
Labrador
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -18 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Golder Retriever
Front Legs Golder Retriever
Head Husky
Ears German Shepard
Snout Schnauzer
Mouth Maltese
Nose Labrador
Eyes Labrador BK
Color Rottweiler