Guido Gus Bitcoin Dog - Mix of German Shepard, Pug, Beagle, Grey Wolf, Yorkshire Terrier, Pitbull terrier, Boxer, Maltese, Labrador, Labrador BK and Rottweiler

Achievements

Racer
Guido Gus
Guido Gus here. Wanna play? I hate it when my human runs out of poop-bags. How embarrassing! Those flying monkeys in the Wizard of Oz still scare me! I enjoy exploration and am game for anything doggy-style. As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 0%
  • Age 39 months
  • Racing Exp 66
  • Mixed-breed
  • 22 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

22 races   |
  • 2 5 0
 Best Time15.27 sec
No rank  Racing *** Pts
31.8 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAGAACTACCCTTATCCAACACCCCAGCACAC
T
C
A
G
A
A
C
T
A
C
C
C
T
T
A
T
C
C
A
A
C
A
C
C
C
C
A
G
C
A
C
A
C
Genes: 72DLFNGK56H

Composition

German Shepard
9%
Pug
9%
Beagle
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Boxer
9%
Maltese
9%
Labrador
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -28 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Beagle
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Pitbull terrier
Snout Boxer
Mouth Maltese
Nose Labrador
Eyes Labrador BK
Color Rottweiler