Misha Montana Crypto Dog - Mix of Golder Retriever, Labrador BK, Shiba Inu, Husky, Corgi, Schnauzer, Border Collie, Grey Wolf, Boxer and Rottweiler

Achievements

Pro Racer
Podium Champion
Misha Montana
Hey, Baby. I'm Misha Montana. I run with a pack in the data warehouse. Fences are just challenges...I don't let them stop me! Forget plastic hotdogs...I'm into the classic chew toys like slippers. I could spend days on end chasing my tail. I get so close but it's just so fast! I 'm here for something RUFF ;)
  • Purity 3%
  • Age 39 months
  • Racing Exp 60
  • Golder Retriever 18%
  • 17 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

17 races   |
  • 3 2 2
 Best Time14.67 sec
No rank  Racing *** Pts
41.2 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAGTAAGAAGAACAAGCATATACCCCAACCAC
G
C
A
G
T
A
A
G
A
A
G
A
A
C
A
A
G
C
A
T
A
T
A
C
C
C
C
A
A
C
C
A
C
Genes: 6E884OCJLGH

Composition

Golder Retriever
18%
Labrador BK
9%
Shiba Inu
9%
Husky
9%
Corgi
9%
Schnauzer
9%
Border Collie
9%
Grey Wolf
9%
Boxer
9%
Rottweiler
9%

Current Energy

Vitality -12 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Golder Retriever
Front Legs Golder Retriever
Head Husky
Ears Corgi
Snout Schnauzer
Mouth Border Collie
Nose Grey Wolf
Eyes Boxer
Color Rottweiler