Misha Montana Crypto Dog - Mix of Golder Retriever, Labrador BK, Shiba Inu, Husky, Corgi, Schnauzer, Border Collie, Grey Wolf, Boxer and Rottweiler

Achievements

Racer
Misha Montana
Hey, Baby. I'm Misha Montana. I run with a pack in the data warehouse. Fences are just challenges...I don't let them stop me! Forget plastic hotdogs...I'm into the classic chew toys like slippers. I could spend days on end chasing my tail. I get so close but it's just so fast! I 'm here for something RUFF ;)
  • Purity 3%
  • Age 43 months
  • Racing Exp 13
  • Golder Retriever 18%
  • 6 races
  • Gen 0
Make him happy share it to your friend*
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 0 0
 Best Time14.67 sec
No rank  Racing *** Coins
16.7 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGTAAGAAGAACAAGCATATACCCCAACCAC
G
C
A
G
T
A
A
G
A
A
G
A
A
C
A
A
G
C
A
T
A
T
A
C
C
C
C
A
A
C
C
A
C
Genes: 6E884OCJLGH

Composition

Golder Retriever
18%
Labrador BK
9%
Shiba Inu
9%
Husky
9%
Corgi
9%
Schnauzer
9%
Border Collie
9%
Grey Wolf
9%
Boxer
9%
Rottweiler
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Golder Retriever
Front Legs Golder Retriever
Head Husky
Ears Corgi
Snout Schnauzer
Mouth Border Collie
Nose Grey Wolf
Eyes Boxer
Color Rottweiler