Zeke Zippy Digital Cryptocurrency Dog - Mix of Golder Retriever, Rottweiler, Labrador BK, Corgi, Shiba Inu and Beagle

Achievements

Racer
Zeke Zippy
Hey, good-looking! This is Zeke Zippy. Someday I'm gonna breakout from inside this server. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'll outrun you for the ball if I can...that's just how I roll.
  • Purity 21%
  • Age 25 months
  • Racing Exp 20
  • Golder Retriever 45%
  • 3 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 2 1
3 races    Best Time16.12 sec
No rank  Racing *** Coins
100.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGAAGAAGAAGAAGCGTACTACACAGACAC
G
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
C
G
T
A
C
T
A
C
A
C
A
G
A
C
A
C
Genes: 68888OEDH8H

Composition

Golder Retriever
45%
Rottweiler
18%
Labrador BK
9%
Corgi
9%
Shiba Inu
9%
Beagle
9%

Current Energy

Vitality -28 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Beagle
Nose Rottweiler
Eyes Golder Retriever
Color Rottweiler