Zeke Zippy Digital Cryptocurrency Dog - Mix of Golder Retriever, Rottweiler, Labrador BK, Corgi, Shiba Inu and Beagle
Zeke Zippy
  • Purity 21%
  • Age 22 months
  • Racing Exp 34
  • Golder Retriever 45%
  • Gold medal 1 Silver medal 2 Bronze medal 2
  • 5 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Hey, good-looking! This is Zeke Zippy. Someday I'm gonna breakout from inside this server. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'll outrun you for the ball if I can...that's just how I roll.

Racing Stats

Ran 5 races
  • 1 2 2
 Best Time16.12 sec
No rank  RacingĀ *** Pts
100.0 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAAGAAGAAGAAGAAGCGTACTACACAGACAC
G
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
C
G
T
A
C
T
A
C
A
C
A
G
A
C
A
C
Genes: 68888OEDH8H

Composition

Golder Retriever
45%
Rottweiler
18%
Labrador BK
9%
Corgi
9%
Shiba Inu
9%
Beagle
9%

Current Energy

Vitality -28 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Beagle
Nose Rottweiler
Eyes Golder Retriever
Color Rottweiler