Evan Emily Bitcoin Dog - Mix of Golder Retriever, Labrador BK, Shiba Inu, Beagle, Labrador and French Bulldog

Achievements

Racer
Evan Emily
You can call me Evan Emily, everybody else does. You can access my database anytime with your WiFi. When my human brushes my coat, I get frisky! If I had to pick a favorite food it would be a hot-dog, because you are what you eat! Getting out of a long relationship, not looking for another
  • Purity 29%
  • Age 23 months
  • Racing Exp 32
  • Golder Retriever 55%
  • 15 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 0 2 1
 Best Time14.95 sec
No rank  Racing *** Pts
20.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAAGAAGAAGAAGAAGAGTACTACCAAGACGA
G
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
G
T
A
C
T
A
C
C
A
A
G
A
C
G
A
Genes: 688888ED589

Composition

Golder Retriever
55%
Labrador BK
9%
Shiba Inu
9%
Beagle
9%
Labrador
9%
French Bulldog
9%

Current Energy

Vitality -28 points
Lunar Effect -18 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Golder Retriever
Snout Shiba Inu
Mouth Beagle
Nose Labrador
Eyes Golder Retriever
Color French Bulldog

Parents

No Children

Photos

crypto pet racing results crypto dog race results cryptocurrency doggy race