Kong Kirby Litecoin Game Dog - Mix of Golder Retriever, Shiba Inu, Dachshund, German Shepard and Corgi

Achievements

Racer
Podium Champion
Kong Kirby
Howdy there. I'm Kong Kirby. Taking a break from chasing Nyan Cat around cyberspace. I love car rides when I can stick my head out the window. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I just want a snuggle buddy with a nice, soft coat.
  • Purity 20%
  • Age 23 months
  • Racing Exp 53
  • Golder Retriever 36%
  • 16 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

16 races   |
  • 2 3 1
 Best Time15.33 sec
No rank  Racing *** Pts
37.5 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATCAAGAAGAAGAAGCGTAGTAGGAAGAGGA
G
T
A
T
C
A
A
G
A
A
G
A
A
G
A
A
G
C
G
T
A
G
T
A
G
G
A
A
G
A
G
G
A
Genes: E7888OEEA8A

Composition

Golder Retriever
36%
Shiba Inu
27%
Dachshund
18%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -40 points
Lunar Effect -16 points

Traits Breakdown

Body Shiba Inu
Tail German Shepard
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Shiba Inu
Nose Dachshund
Eyes Golder Retriever
Color Dachshund