Bruiser Bond Crypto Dog - Mix of Dachshund, Golder Retriever, German Shepard and Pug

Achievements

None
Bruiser Bond
I'm totally against baths! They are the worst! I'm going kill that damn Nyan Cat if I can catch it. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! I want to find that special friend who enjoys sharing each other's doggie bags.
  • Purity 28%
  • Age 25 months
  • Racing Exp 0
  • Dachshund 45%
  • 0 races
  • Gen 5
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCAAGAAGAGGAGGAGGAGAAGGAAGAGGA
T
C
A
T
C
A
A
G
A
A
G
A
G
G
A
G
G
A
G
G
A
G
A
A
G
G
A
A
G
A
G
G
A
Genes: 7788AAA2A8A

Composition

Dachshund
45%
Golder Retriever
27%
German Shepard
18%
Pug
9%

Current Energy

Vitality -17 points
Lunar Effect -20 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Golder Retriever
Front Legs Golder Retriever
Head Dachshund
Ears Dachshund
Snout Dachshund
Mouth Pug
Nose Dachshund
Eyes Golder Retriever
Color Dachshund

Parents

No Children