Kujo Kobe Bitcoin Dog - Mix of Dachshund, German Shepard, Corgi, Rottweiler, Labrador BK, Pug, Grey Wolf, Husky and Labrador

Achievements

Pro Racer
Kujo Kobe
Wassup? Yo, call me Kujo Kobe. I'm having some new data architecture built for me, then I'd like to have you over to my place. I love a good book... I find them quite tasty. My idea of romance would be to stroll through in the dog park then share a meaty bone with you.
  • Purity 8%
  • Age 26 months
  • Racing Exp 51
  • Dachshund 27%
  • 11 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 5 0 1
11 races    Best Time15.17 sec
No rank  Racing *** Coins
54.5 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCCACGCAGGAGGAGGAGAACCCACACCA
T
C
A
A
G
C
C
A
C
G
C
A
G
G
A
G
G
A
G
G
A
G
A
A
C
C
C
A
C
A
C
C
A
Genes: 7OH6AAA2L45

Composition

Dachshund
27%
German Shepard
9%
Corgi
9%
Rottweiler
9%
Labrador BK
9%
Pug
9%
Grey Wolf
9%
Husky
9%
Labrador
9%

Current Energy

Vitality -11 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Rottweiler
Front Legs Labrador BK
Head Dachshund
Ears Dachshund
Snout Dachshund
Mouth Pug
Nose Grey Wolf
Eyes Husky
Color Labrador