Piggy Pebbles Virtual Crypto Game Dog - Mix of Shiba Inu, Dachshund, German Shepard, Rottweiler, Husky and Beagle

Achievements

Racer
Podium Champion
Piggy Pebbles
I've been known to take mega bytes when playing ruff. I enjoy staying active, and running circles around puppies and young children. If I can't reach it to clean it myself, it doesn't need cleaning! I hate it when humans put the lid down. Rolling around on the carpet after a bath is my favorite way to dry.
  • Purity 15%
  • Age 24 months
  • Racing Exp 43
  • Shiba Inu 36%
  • 15 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 1 1 3
 Best Time15.58 sec
No rank  Racing *** Pts
33.3 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATCACACACAGTAGTAGGAGTAGGACTAGGA
G
T
A
T
C
A
C
A
C
A
C
A
G
T
A
G
T
A
G
G
A
G
T
A
G
G
A
C
T
A
G
G
A
Genes: E7H4EEAEADA

Composition

Shiba Inu
36%
Dachshund
27%
German Shepard
9%
Rottweiler
9%
Husky
9%
Beagle
9%

Current Energy

Vitality -23 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail German Shepard
Legs Rottweiler
Front Legs Husky
Head Shiba Inu
Ears Shiba Inu
Snout Dachshund
Mouth Shiba Inu
Nose Dachshund
Eyes Beagle
Color Dachshund