Jamie Jago Crypto Dog - Mix of Shiba Inu, German Shepard, Labrador, Beagle and French Bulldog

Achievements

Racer
Podium Champion
Jamie Jago
I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! My humans should try spending 8 hours a day in a crate! If I can't reach it to clean it myself, it doesn't need cleaning! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 20%
  • Age 23 months
  • Racing Exp 44
  • Shiba Inu 36%
  • 14 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

14 races   |
  • 1 3 1
 Best Time14.58 sec
No rank  Racing *** Pts
35.7 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATCATCATCAGTAGTACCAGTACCACTACGA
G
T
A
T
C
A
T
C
A
T
C
A
G
T
A
G
T
A
C
C
A
G
T
A
C
C
A
C
T
A
C
G
A
Genes: E777EE5E5D9

Composition

Shiba Inu
36%
German Shepard
27%
Labrador
18%
Beagle
9%
French Bulldog
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Labrador
Eyes Beagle
Color French Bulldog