Shelly Simone Litecoin Dog - Mix of Shiba Inu, German Shepard, French Bulldog, Rottweiler, Corgi and Beagle

Achievements

Racer
Podium Champion
Shelly Simone
Barkjour mi amor! I'm Shelly Simone. When I can break free, I enjoy exploring my neighborhood without my human. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I'm looking for some ruff play. Wanna bite me?
  • Purity 13%
  • Age 23 months
  • Racing Exp 57
  • Shiba Inu 36%
  • 18 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

18 races   |
  • 1 2 4
 Best Time14.70 sec
No rank  Racing *** Pts
38.9 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATCACGATCAGTAGTACACGTAAGCCTACGA
G
T
A
T
C
A
C
G
A
T
C
A
G
T
A
G
T
A
C
A
C
G
T
A
A
G
C
C
T
A
C
G
A
Genes: E797EEHEOD9

Composition

Shiba Inu
36%
German Shepard
18%
French Bulldog
18%
Rottweiler
9%
Corgi
9%
Beagle
9%

Current Energy

Vitality -25 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail German Shepard
Legs French Bulldog
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout Rottweiler
Mouth Shiba Inu
Nose Corgi
Eyes Beagle
Color French Bulldog

Parents

No Children

Photos

online doggy race podium crypto doggy race results virtual dog race results Bitcoin dog racing cryptocurrency dog racing cryptocurrency canine racing photo Bitcoin dog racing cryptocurrency pet racing photo