Verona Viva Digital Cryptocurrency Dog - Mix of Beagle, Corgi, Boxer, Schnauzer, French Bulldog, Labrador BK, Rottweiler, Dachshund and Yorkshire Terrier

Achievements

None
Verona Viva
Top o' the mornin' to ya! I'm Verona Viva. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I need laid otherwise I'm going to start agreeing with Grumpy Cat. My human is my best friend, looking for someone who is okay with that.
  • Purity 7%
  • Age 25 months
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACATACGAGCACTACTACACGGAAGCAGCTTA
A
A
C
A
T
A
C
G
A
G
C
A
C
T
A
C
T
A
C
A
C
G
G
A
A
G
C
A
G
C
T
T
A
Genes: GC96DDHAOOF

Composition

Beagle
18%
Corgi
18%
Boxer
9%
Schnauzer
9%
French Bulldog
9%
Labrador BK
9%
Rottweiler
9%
Dachshund
9%
Yorkshire Terrier
9%

Current Energy

Vitality -35 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs French Bulldog
Front Legs Labrador BK
Head Beagle
Ears Beagle
Snout Rottweiler
Mouth Dachshund
Nose Corgi
Eyes Corgi
Color Yorkshire Terrier