Beanie Buffalo Bill Virtual Crypto Game Dog - Mix of Shiba Inu, Labrador BK, Corgi, French Bulldog, Beagle and Yorkshire Terrier
Beanie Buffalo Bill
  • Purity 15%
  • Age 14 months
  • Racing Exp 0
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 11
Depressed & Snaillike

Achievements

None

Bio

Here in cyberspace, I ain't got much use for a floppy disc. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I like to work out by digging fresh holes in landscaped yards. They say my bite is worse than my bark.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GTAGCACGAGCAGTACTAGTAGTAAGCAGCTTA
G
T
A
G
C
A
C
G
A
G
C
A
G
T
A
C
T
A
G
T
A
G
T
A
A
G
C
A
G
C
T
T
A
Genes: E696EDEEOOF

Composition

Shiba Inu
36%
Labrador BK
18%
Corgi
18%
French Bulldog
9%
Beagle
9%
Yorkshire Terrier
9%

Current Energy

Vitality -31 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Labrador BK
Legs French Bulldog
Front Legs Labrador BK
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Shiba Inu
Nose Corgi
Eyes Corgi
Color Yorkshire Terrier

Parents

No Children

Gift