Tobie Tizzy Litecoin Dog - Mix of Shiba Inu, Labrador BK, Corgi, Beagle and Pug
Tobie Tizzy
  • Purity 23%
  • Age 16 months
  • Racing Exp 0
  • Shiba Inu 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 10
Depressed & Snaillike

Achievements

None

Bio

I love connecting with my friends via pee-mail. Sometimes I forget where I buried my bone. Slipping my collar, running off and making my humans worried? Every chance I get. I don't like having to stay off the furniture. I need someone that "brings home the bacon"!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GTAGCAAGCGCAGTACTAGTAGTAGTAGAAGCA
G
T
A
G
C
A
A
G
C
G
C
A
G
T
A
C
T
A
G
T
A
G
T
A
G
T
A
G
A
A
G
C
A
Genes: E6O6EDEEE26

Composition

Shiba Inu
45%
Labrador BK
27%
Corgi
9%
Beagle
9%
Pug
9%

Current Energy

Vitality -31 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Labrador BK
Legs Corgi
Front Legs Labrador BK
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Pug
Color Labrador BK