Tobie Tizzy Litecoin Dog - Mix of Shiba Inu, Labrador BK, Corgi, Beagle and Pug

Achievements

None
Tobie Tizzy
I love connecting with my friends via pee-mail. Sometimes I forget where I buried my bone. Slipping my collar, running off and making my humans worried? Every chance I get. I don't like having to stay off the furniture. I need someone that "brings home the bacon"!
  • Purity 23%
  • Age 22 months
  • Racing Exp 0
  • Shiba Inu 45%
  • 0 races
  • Gen 10
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGCAAGCGCAGTACTAGTAGTAGTAGAAGCA
G
T
A
G
C
A
A
G
C
G
C
A
G
T
A
C
T
A
G
T
A
G
T
A
G
T
A
G
A
A
G
C
A
Genes: E6O6EDEEE26

Composition

Shiba Inu
45%
Labrador BK
27%
Corgi
9%
Beagle
9%
Pug
9%

Current Energy

Vitality -31 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Labrador BK
Legs Corgi
Front Legs Labrador BK
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Pug
Color Labrador BK