Raven Rosco Bitcoin Dog - Mix of Labrador BK, Labrador, Poodle, Corgi, Beagle, St. Bernard, Golder Retriever and Pug

Achievements

Racer
Podium Champion
Raven Rosco
I have a crush on the Grumpy cat. As a designer, I suggest low windows or couch backs next to windows without curtains. I love waking up early then indulging in long afternoon naps. As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 6%
  • Age 41 months
  • Racing Exp 57
  • Labrador BK 27%
  • 20 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 2 3 1
20 races    Best Time14.33 sec
Rank 12  Racing *** Coins
30.0 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGCAAGCGCACCACTATGAAGACCAGAAGCA
G
A
C
G
C
A
A
G
C
G
C
A
C
C
A
C
T
A
T
G
A
A
G
A
C
C
A
G
A
A
G
C
A
Genes: I6O65DB8526

Composition

Labrador BK
27%
Labrador
18%
Poodle
9%
Corgi
9%
Beagle
9%
St. Bernard
9%
Golder Retriever
9%
Pug
9%

Current Energy

Vitality -38 points
Lunar Effect -12 points

Traits Breakdown

Body Poodle
Tail Labrador BK
Legs Corgi
Front Legs Labrador BK
Head Labrador
Ears Beagle
Snout St. Bernard
Mouth Golder Retriever
Nose Labrador
Eyes Pug
Color Labrador BK