Fritz Flakey Bitcoin Game Dog - Mix of Labrador BK, St. Bernard, Corgi, Rottweiler, Maltese, Border Collie and Golder Retriever

Achievements

Racer
Podium Champion
Fritz Flakey
Howdy there. I'm Fritz Flakey. Too much steak gives me the runs! I don't like going to the groomer. Leave my beautiful fur alone! I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I love car rides when I can stick my head out the window.
  • Purity 11%
  • Age 18 months
  • Racing Exp 47
  • Labrador BK 27%
  • 18 races
  • Gen 1
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

18 races   |
  • 1 2 2
 Best Time15.45 sec
No rank  Racing *** Pts
27.8 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTGAAGCGCAGCAGCATGAACCTACAGCAGA
C
A
C
T
G
A
A
G
C
G
C
A
G
C
A
G
C
A
T
G
A
A
C
C
T
A
C
A
G
C
A
G
A
Genes: HBO666BKJO8

Composition

Labrador BK
27%
St. Bernard
18%
Corgi
18%
Rottweiler
9%
Maltese
9%
Border Collie
9%
Golder Retriever
9%

Current Energy

Vitality -33 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Corgi
Front Legs Labrador BK
Head Labrador BK
Ears Labrador BK
Snout St. Bernard
Mouth Maltese
Nose Border Collie
Eyes Corgi
Color Golder Retriever