Yardwork Yukon Litecoin Dog - Mix of Labrador BK, Rottweiler, St. Bernard, German Shepard, Maltese, Border Collie, Corgi and Golder Retriever
Yardwork Yukon
  • Purity 9%
  • Age 18 months
  • Racing Exp 42
  • Labrador BK 27%
  • Gold medal 2 Silver medal 2 Bronze medal 1
  • 11 races
  • Gen 0
Ecstatic & Fast

Achievements

Podium Champion
Pro Racer

Bio

I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I love cuddling up, doggy-style after a romantic evening. I'm going kill that damn Nyan Cat if I can catch it. Steak is my absolute favorite, but I prefer to eat chicken for my health.

Racing Stats

Ran 11 races
  • 2 2 1
 Best Time15.65 sec
Rank 75  RacingĀ *** Pts
45.5 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACTGATCAGCAGCAGCACACACCTACAGCAGA
C
A
C
T
G
A
T
C
A
G
C
A
G
C
A
G
C
A
C
A
C
A
C
C
T
A
C
A
G
C
A
G
A
Genes: HB7666HKJO8

Composition

Labrador BK
27%
Rottweiler
18%
St. Bernard
9%
German Shepard
9%
Maltese
9%
Border Collie
9%
Corgi
9%
Golder Retriever
9%

Current Energy

Vitality -20 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs German Shepard
Front Legs Labrador BK
Head Labrador BK
Ears Labrador BK
Snout Rottweiler
Mouth Maltese
Nose Border Collie
Eyes Corgi
Color Golder Retriever