June Bug Jiminy Crypto Dog - Mix of St. Bernard, Border Collie and Labrador BK
June Bug Jiminy
  • Purity 65%
  • Age 13 months
  • Racing Exp 2
  • St. Bernard 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 13
Depressed & Snaillike

Achievements

Racer

Bio

Currently, I live on the information superhighway. I never knew my father. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. As a designer, I suggest low windows or couch backs next to windows without curtains. I'm ready to settle down and have puppies...what about you?

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.75 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TGATGATACTGATGAGCATGATGATGATGATGA
T
G
A
T
G
A
T
A
C
T
G
A
T
G
A
G
C
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: BBJBB6BBBBB

Composition

St. Bernard
82%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -29 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs Border Collie
Front Legs St. Bernard
Head St. Bernard
Ears Labrador BK
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard

Parents

No Children

Photos

Gift