June Bug Jiminy Crypto Dog - Mix of St. Bernard, Border Collie and Labrador BK

Achievements

Racer
June Bug Jiminy
Currently, I live on the information superhighway. I never knew my father. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. As a designer, I suggest low windows or couch backs next to windows without curtains. I'm ready to settle down and have puppies...what about you?
  • Purity 65%
  • Age 21 months
  • Racing Exp 10
  • St. Bernard 82%
  • 3 races
  • Gen 13
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
3 races    Best Time16.75 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATGATACTGATGAGCATGATGATGATGATGA
T
G
A
T
G
A
T
A
C
T
G
A
T
G
A
G
C
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: BBJBB6BBBBB

Composition

St. Bernard
82%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -29 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs Border Collie
Front Legs St. Bernard
Head St. Bernard
Ears Labrador BK
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard