Tailgate Tuesday Bitcoin Game Dog - Mix of St. Bernard, Border Collie and Labrador
Tailgate Tuesday
  • Purity 65%
  • Age 13 months
  • Racing Exp 8
  • St. Bernard 82%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 12
Depressed & Snaillike

Achievements

Racer

Bio

Hola! My name is Tailgate Tuesday. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I really enjoy heavy petting. I'm willing to try little bondage, so my human chained me up! Getting out of a long relationship, not looking for another

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time16.30 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TGATGATACTGATGACCATGATGATGATGATGA
T
G
A
T
G
A
T
A
C
T
G
A
T
G
A
C
C
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: BBJBB5BBBBB

Composition

St. Bernard
82%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -29 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs Border Collie
Front Legs St. Bernard
Head St. Bernard
Ears Labrador
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard