Tailgate Tuesday Bitcoin Game Dog - Mix of St. Bernard, Border Collie and Labrador

Achievements

Racer
Tailgate Tuesday
Hola! My name is Tailgate Tuesday. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I really enjoy heavy petting. I'm willing to try little bondage, so my human chained me up! Getting out of a long relationship, not looking for another
  • Purity 65%
  • Age 20 months
  • Racing Exp 9
  • St. Bernard 82%
  • 2 races
  • Gen 12
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
2 races    Best Time16.30 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATGATACTGATGACCATGATGATGATGATGA
T
G
A
T
G
A
T
A
C
T
G
A
T
G
A
C
C
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: BBJBB5BBBBB

Composition

St. Bernard
82%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -29 points
Lunar Effect +20 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs Border Collie
Front Legs St. Bernard
Head St. Bernard
Ears Labrador
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard