Lights Out Linux Bitcoin Dog - Mix of St. Bernard, German Shepard, Shiba Inu, Poodle and Pitbull terrier
Lights Out Linux
  • Purity 40%
  • Age 16 months
  • Racing Exp 1
  • St. Bernard 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 10
Depressed & Snaillike

Achievements

Racer

Bio

I'm Lights Out Linux. What do they call you? Hope you like the smell of wet fur, because I'll jump into any water I see! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... As long as we are headed in the same direction, I say we try hanging out for a while.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.10 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TGATCAGTATGATGAGACTCCTGATGATGATGA
T
G
A
T
C
A
G
T
A
T
G
A
T
G
A
G
A
C
T
C
C
T
G
A
T
G
A
T
G
A
T
G
A
Genes: B7EBBINBBBB

Composition

St. Bernard
64%
German Shepard
9%
Shiba Inu
9%
Poodle
9%
Pitbull terrier
9%

Current Energy

Vitality -50 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail German Shepard
Legs Shiba Inu
Front Legs St. Bernard
Head St. Bernard
Ears Poodle
Snout Pitbull terrier
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard