Snowy Squirt Bitcoin Game Dog - Pure St. Bernard
Snowy Squirt
  • Purity 100%
  • Age 33 months
  • Racing Exp 1
  • St. Bernard 100%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 9
Depressed & Snaillike

Achievements

First Pure Breed Dog
Racer

Bio

Hello, I'm Snowy Squirt. How's it goin'? I run with a pack in the data warehouse. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I'll be honest...Napping is my favorite so we gotta go slow. You scratch my belly and I'll scratch yours ;)

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.47 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TGATGATGATGATGATGATGATGATGATGATGA
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: BBBBBBBBBBB

Composition

St. Bernard
100%

Current Energy

Vitality -45 points
Lunar Effect +24 points

Traits Breakdown

Traits 100% Purebred St. Bernard