Zeke Zilch Litecoin Dog - Mix of Boxer, Beagle, Shiba Inu, Yorkshire Terrier, Border Collie, Rottweiler and St. Bernard

Achievements

Racer
Zeke Zilch
I answer to 'Zeke Zilch'. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. Rolling around on the carpet after a bath is my favorite way to dry. It turns me on when I can show an older dog a new trick. I'd like to help you shed your coat, baby.
  • Purity 9%
  • Age 38 months
  • Racing Exp 1
  • Boxer 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time15.62 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTATACAACAACCTAAACGTACACTGACTAGTA
T
T
A
T
A
C
A
A
C
A
A
C
C
T
A
A
A
C
G
T
A
C
A
C
T
G
A
C
T
A
G
T
A
Genes: FJGGDGEHBDE

Composition

Boxer
27%
Beagle
18%
Shiba Inu
18%
Yorkshire Terrier
9%
Border Collie
9%
Rottweiler
9%
St. Bernard
9%

Current Energy

Vitality -47 points
Lunar Effect +12 points

Traits Breakdown

Body Yorkshire Terrier
Tail Border Collie
Legs Boxer
Front Legs Boxer
Head Beagle
Ears Boxer
Snout Shiba Inu
Mouth Rottweiler
Nose St. Bernard
Eyes Beagle
Color Shiba Inu