Chica Cleo Bitcoin Game Dog - Mix of St. Bernard, Husky, Grey Wolf, German Shepard, Shiba Inu, Poodle, Pitbull terrier and Labrador BK

Achievements

Podium Champion
Pro Racer
Chica Cleo
Hey, good-looking! This is Chica Cleo. I run exclusively on code. Dragging my butt on the carpet feels so good. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I could spend days on end chasing my tail. I get so close but it's just so fast!
  • Purity 9%
  • Age 39 months
  • Racing Exp 77
  • St. Bernard 27%
  • 20 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

20 races   |
  • 5 2 2
 Best Time15.28 sec
No rank  Racing *** Pts
45.0 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCTCAGTAACAACAGACTCCTGAGCATGATGA
C
C
C
T
C
A
G
T
A
A
C
A
A
C
A
G
A
C
T
C
C
T
G
A
G
C
A
T
G
A
T
G
A
Genes: L7E44INB6BB

Composition

St. Bernard
27%
Husky
18%
Grey Wolf
9%
German Shepard
9%
Shiba Inu
9%
Poodle
9%
Pitbull terrier
9%
Labrador BK
9%

Current Energy

Vitality -10 points
Lunar Effect 0 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Shiba Inu
Front Legs Husky
Head Husky
Ears Poodle
Snout Pitbull terrier
Mouth St. Bernard
Nose Labrador BK
Eyes St. Bernard
Color St. Bernard