Moana Meggie Bitcoin Dog - Mix of Shiba Inu, St. Bernard, Beagle, German Shepard, Husky, Poodle and Labrador BK

Achievements

Racer
Moana Meggie
I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I love it when you show a little teeth. My human's feet are definitely the greatest smell ever. Especially after a long day at work! Just looking to sow some wild oats here...
  • Purity 12%
  • Age 20 months
  • Racing Exp 2
  • Shiba Inu 27%
  • 2 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time16.85 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATCAGTAGTAACAGACGTATGAGCATGATGA
C
T
A
T
C
A
G
T
A
G
T
A
A
C
A
G
A
C
G
T
A
T
G
A
G
C
A
T
G
A
T
G
A
Genes: D7EE4IEB6BB

Composition

Shiba Inu
27%
St. Bernard
27%
Beagle
9%
German Shepard
9%
Husky
9%
Poodle
9%
Labrador BK
9%

Current Energy

Vitality -40 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Shiba Inu
Front Legs Shiba Inu
Head Husky
Ears Poodle
Snout Shiba Inu
Mouth St. Bernard
Nose Labrador BK
Eyes St. Bernard
Color St. Bernard