Misha Macy Crypto Game Dog - Mix of Shiba Inu, Boxer, German Shepard, Beagle, French Bulldog and Dachshund

Achievements

Racer
Misha Macy
A-yo...Call me Misha Macy. I pee when I'm excited. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I want someone who can show me a good time; I'll do the same for you.
  • Purity 17%
  • Age 28 months
  • Racing Exp 7
  • Shiba Inu 36%
  • 1 races
  • Gen 2
Make him happy share it to your friend*
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time16.15 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAAACGTAGTACGAAACGTAGTAGGATCATCA
C
T
A
A
A
C
G
T
A
G
T
A
C
G
A
A
A
C
G
T
A
G
T
A
G
G
A
T
C
A
T
C
A
Genes: DGEE9GEEA77

Composition

Shiba Inu
36%
Boxer
18%
German Shepard
18%
Beagle
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -60 points
Lunar Effect +10 points

Traits Breakdown

Body Beagle
Tail Boxer
Legs Shiba Inu
Front Legs Shiba Inu
Head French Bulldog
Ears Boxer
Snout Shiba Inu
Mouth Shiba Inu
Nose Dachshund
Eyes German Shepard
Color German Shepard