Misha Macy Crypto Game Dog - Mix of Shiba Inu, Boxer, German Shepard, Beagle, French Bulldog and Dachshund

Achievements

Racer
Misha Macy
A-yo...Call me Misha Macy. I pee when I'm excited. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I want someone who can show me a good time; I'll do the same for you.
  • Purity 17%
  • Age 24 months
  • Racing Exp 25
  • Shiba Inu 36%
  • 5 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

5 races   |
  • 2 1 0
 Best Time15.67 sec
No rank  Racing *** Pts
60.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAAACGTAGTACGAAACGTAGTAGGATCATCA
C
T
A
A
A
C
G
T
A
G
T
A
C
G
A
A
A
C
G
T
A
G
T
A
G
G
A
T
C
A
T
C
A
Genes: DGEE9GEEA77

Composition

Shiba Inu
36%
Boxer
18%
German Shepard
18%
Beagle
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -60 points
Lunar Effect -2 points

Traits Breakdown

Body Beagle
Tail Boxer
Legs Shiba Inu
Front Legs Shiba Inu
Head French Bulldog
Ears Boxer
Snout Shiba Inu
Mouth Shiba Inu
Nose Dachshund
Eyes German Shepard
Color German Shepard