Bug Buffie Bitcoin Game Dog - Mix of Shiba Inu, French Bulldog, Beagle, Labrador, Labrador BK, Border Collie, Golder Retriever and German Shepard

Achievements

Racer
Bug Buffie
Whatcha know, honey. Bug Buffie here. I'm willing to try little bondage, so my human chained me up! I love car rides when I can stick my head out the window. I love the smell of freshly cut grass. Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 9%
  • Age 40 months
  • Racing Exp 1
  • Shiba Inu 27%
  • 1 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.13 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTACCAGTAGCACGACGAGTAGTATACAGATCA
C
T
A
C
C
A
G
T
A
G
C
A
C
G
A
C
G
A
G
T
A
G
T
A
T
A
C
A
G
A
T
C
A
Genes: D5E699EEJ87

Composition

Shiba Inu
27%
French Bulldog
18%
Beagle
9%
Labrador
9%
Labrador BK
9%
Border Collie
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -49 points
Lunar Effect -10 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs Shiba Inu
Front Legs Labrador BK
Head French Bulldog
Ears French Bulldog
Snout Shiba Inu
Mouth Shiba Inu
Nose Border Collie
Eyes Golder Retriever
Color German Shepard