Butterball Bernard Bitcoin Game Dog - Mix of Shiba Inu, French Bulldog, Golder Retriever, Beagle, Maltese, Labrador BK and German Shepard

Achievements

None
Butterball Bernard
Nice to meet you! I'm Butterball Bernard. I'll lick anything. I like nibbling on most everything, but I'll bite if you want me to. I'm not into dog collars, unless you're into S & M. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 13%
  • Age 41 months
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAACCGTAGCACGACGAGTAGTAAGAAGATCA
C
T
A
A
C
C
G
T
A
G
C
A
C
G
A
C
G
A
G
T
A
G
T
A
A
G
A
A
G
A
T
C
A
Genes: DKE699EE887

Composition

Shiba Inu
27%
French Bulldog
18%
Golder Retriever
18%
Beagle
9%
Maltese
9%
Labrador BK
9%
German Shepard
9%

Current Energy

Vitality -49 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Shiba Inu
Front Legs Labrador BK
Head French Bulldog
Ears French Bulldog
Snout Shiba Inu
Mouth Shiba Inu
Nose Golder Retriever
Eyes Golder Retriever
Color German Shepard