Merlin Maui Litecoin Dog - Mix of Shiba Inu, German Shepard, Beagle, Maltese, Labrador BK, French Bulldog and Golder Retriever

Achievements

None
Merlin Maui
Wassup? Yo, call me Merlin Maui. I'm a serial monogamist. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I don't like going to the groomer. Leave my beautiful fur alone! I'm always up for a nice long walk around the neighborhood.
  • Purity 12%
  • Age 40 months
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAACCGTAGCAGTACGAGTAGTATCAAGATCA
C
T
A
A
C
C
G
T
A
G
C
A
G
T
A
C
G
A
G
T
A
G
T
A
T
C
A
A
G
A
T
C
A
Genes: DKE6E9EE787

Composition

Shiba Inu
36%
German Shepard
18%
Beagle
9%
Maltese
9%
Labrador BK
9%
French Bulldog
9%
Golder Retriever
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Shiba Inu
Front Legs Labrador BK
Head Shiba Inu
Ears French Bulldog
Snout Shiba Inu
Mouth Shiba Inu
Nose German Shepard
Eyes Golder Retriever
Color German Shepard