Sassie Sonny Crypto Game Dog - Mix of Shiba Inu, German Shepard, French Bulldog, Schnauzer, Dachshund, Maltese, Grey Wolf, Beagle and St. Bernard

Achievements

Racer
Sassie Sonny
I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. Sometimes I just have to roll in something dead. I'll be honest...Napping is my favorite so we gotta go slow. I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 3%
  • Age 38 months
  • Racing Exp 2
  • Shiba Inu 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time16.12 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGAATAGGAACCGTACCCTCAGTATCACTATGA
C
G
A
A
T
A
G
G
A
A
C
C
G
T
A
C
C
C
T
C
A
G
T
A
T
C
A
C
T
A
T
G
A
Genes: 9CAKEL7E7DB

Composition

Shiba Inu
18%
German Shepard
18%
French Bulldog
9%
Schnauzer
9%
Dachshund
9%
Maltese
9%
Grey Wolf
9%
Beagle
9%
St. Bernard
9%

Current Energy

Vitality -56 points
Lunar Effect -16 points

Traits Breakdown

Body French Bulldog
Tail Schnauzer
Legs Dachshund
Front Legs Maltese
Head Shiba Inu
Ears Grey Wolf
Snout German Shepard
Mouth Shiba Inu
Nose German Shepard
Eyes Beagle
Color St. Bernard

Parents

Children

Photos