Shamus Steffi Bitcoin Dog - Mix of Shiba Inu, Beagle, St. Bernard, French Bulldog, Boxer, Pug and Labrador

Achievements

Racer
Shamus Steffi
How do you do? I'm Shamus Steffi. I hate it when my human runs out of poop-bags. How embarrassing! Squeaky toys are the best, don't you agree? When I hook up, I stay hooked up for about 20 minutes. My human says I'm loyal, intelligent, devoted and affectionate. I just want a snuggle buddy with a nice, soft coat.
  • Purity 20%
  • Age 26 months
  • Racing Exp 1
  • Shiba Inu 45%
  • 1 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.80 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATGAGTAGTACGAAACGTAGTAGTAGAACCA
C
T
A
T
G
A
G
T
A
G
T
A
C
G
A
A
A
C
G
T
A
G
T
A
G
T
A
G
A
A
C
C
A
Genes: DBEE9GEEE25

Composition

Shiba Inu
45%
Beagle
9%
St. Bernard
9%
French Bulldog
9%
Boxer
9%
Pug
9%
Labrador
9%

Current Energy

Vitality -55 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail St. Bernard
Legs Shiba Inu
Front Legs Shiba Inu
Head French Bulldog
Ears Boxer
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Pug
Color Labrador

Parents

No Children

Photos