Pepper Picasso Litecoin Dog - Mix of Labrador, St. Bernard, Grey Wolf, Border Collie, Dachshund, Golder Retriever, Shiba Inu and Pug

Achievements

None
Pepper Picasso
Hello, there. Pepper Picasso here. I enjoy mixing it up once in a while by visiting different dog parks. I'll eat my vomit and yours too. Shy dogs that tuck tail bore me. My favorite game is Fetch except I never bring the ball back. I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 6%
  • Age 27 months
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTGACCATACTGAGGAAGACCAGTAGAACCA
C
C
C
T
G
A
C
C
A
T
A
C
T
G
A
G
G
A
A
G
A
C
C
A
G
T
A
G
A
A
C
C
A
Genes: LB5JBA85E25

Composition

Labrador
27%
St. Bernard
18%
Grey Wolf
9%
Border Collie
9%
Dachshund
9%
Golder Retriever
9%
Shiba Inu
9%
Pug
9%

Current Energy

Vitality -1 points
Lunar Effect +4 points

Traits Breakdown

Body Grey Wolf
Tail St. Bernard
Legs Labrador
Front Legs Border Collie
Head St. Bernard
Ears Dachshund
Snout Golder Retriever
Mouth Labrador
Nose Shiba Inu
Eyes Pug
Color Labrador