Ricky Reptile Crypto Dog - Mix of Labrador, Beagle, Boxer, St. Bernard, Border Collie, Golder Retriever, Corgi and Pug
Ricky Reptile
  • Purity 8%
  • Age 14 months
  • Racing Exp 103
  • Labrador 27%
  • Gold medal 6 Silver medal 4 Bronze medal 2
  • 27 races
  • Gen 1
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

Hi, Ricky Reptile is my name. Currently, I live on the information superhighway. I am not above stealing food off humans' plates. I love a good book... I find them quite tasty. I'm not into dog collars, unless you're into S & M. I need someone that "brings home the bacon"!

Racing Stats

Ran 27 races
  • 6 4 2
 Best Time14.57 sec
Rank 78  RacingĀ *** Pts
44.4 % wins (12) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AACTGACCATACCTACTAAGACCAAGCGAACCA
A
A
C
T
G
A
C
C
A
T
A
C
C
T
A
C
T
A
A
G
A
C
C
A
A
G
C
G
A
A
C
C
A
Genes: GB5JDD85O25

Composition

Labrador
27%
Beagle
18%
Boxer
9%
St. Bernard
9%
Border Collie
9%
Golder Retriever
9%
Corgi
9%
Pug
9%

Current Energy

Vitality -26 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail St. Bernard
Legs Labrador
Front Legs Border Collie
Head Beagle
Ears Beagle
Snout Golder Retriever
Mouth Labrador
Nose Corgi
Eyes Pug
Color Labrador