Cha Cha Corky Digital Cryptocurrency Game Dog - Mix of Labrador, Beagle, Golder Retriever, Labrador BK, Husky, German Shepard, Yorkshire Terrier and Pug
Cha Cha Corky
  • Purity 6%
  • Age 16 months
  • Racing Exp 24
  • Labrador 18%
  • Gold medal 2 Silver medal 0 Bronze medal 1
  • 5 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

If you'd like to get together, I'm Cha Cha Corky. Virtually, I'll come whenever you call. Little Bow Wow is my favorite musician. I just assume he's a dog... I hate having to wear foo-foo clothes and ribbons in my fur. I want to find that special friend who enjoys sharing each other's doggie bags.

Racing Stats

Ran 5 races
  • 2 0 1
 Best Time15.12 sec
Rank 22  RacingĀ *** Pts
60.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAACACCATCACTACTAAGACCATTAGAAAGA
G
C
A
A
C
A
C
C
A
T
C
A
C
T
A
C
T
A
A
G
A
C
C
A
T
T
A
G
A
A
A
G
A
Genes: 6457DD85F28

Composition

Labrador
18%
Beagle
18%
Golder Retriever
18%
Labrador BK
9%
Husky
9%
German Shepard
9%
Yorkshire Terrier
9%
Pug
9%

Current Energy

Vitality -13 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Labrador
Front Legs German Shepard
Head Beagle
Ears Beagle
Snout Golder Retriever
Mouth Labrador
Nose Yorkshire Terrier
Eyes Pug
Color Golder Retriever

Parents

No Children

Photos

Litecoin pet racing photo virtual pet race online dog race photo
Gift