Cha Cha Corky Digital Cryptocurrency Game Dog - Mix of Labrador, Beagle, Golder Retriever, Labrador BK, Husky, German Shepard, Yorkshire Terrier and Pug

Achievements

Podium Champion
Pro Racer
Master Champion
Cha Cha Corky
If you'd like to get together, I'm Cha Cha Corky. Virtually, I'll come whenever you call. Little Bow Wow is my favorite musician. I just assume he's a dog... I hate having to wear foo-foo clothes and ribbons in my fur. I want to find that special friend who enjoys sharing each other's doggie bags.
  • Purity 6%
  • Age 18 months
  • Racing Exp 109
  • Labrador 18%
  • 28 races
  • Gen 2
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

28 races   |
  • 4 3 7
 Best Time14.47 sec
No rank  Racing *** Pts
50.0 % wins (14) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: GCAACACCATCACTACTAAGACCATTAGAAAGA
G
C
A
A
C
A
C
C
A
T
C
A
C
T
A
C
T
A
A
G
A
C
C
A
T
T
A
G
A
A
A
G
A
Genes: 6457DD85F28

Composition

Labrador
18%
Beagle
18%
Golder Retriever
18%
Labrador BK
9%
Husky
9%
German Shepard
9%
Yorkshire Terrier
9%
Pug
9%

Current Energy

Vitality -13 points
Lunar Effect -2 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Labrador
Front Legs German Shepard
Head Beagle
Ears Beagle
Snout Golder Retriever
Mouth Labrador
Nose Yorkshire Terrier
Eyes Pug
Color Golder Retriever