Cha Cha Corky Digital Cryptocurrency Game Dog - Mix of Labrador, Beagle, Golder Retriever, Labrador BK, Husky, German Shepard, Yorkshire Terrier and Pug

Achievements

Racer
Cha Cha Corky
If you'd like to get together, I'm Cha Cha Corky. Virtually, I'll come whenever you call. Little Bow Wow is my favorite musician. I just assume he's a dog... I hate having to wear foo-foo clothes and ribbons in my fur. I want to find that special friend who enjoys sharing each other's doggie bags.
  • Purity 6%
  • Age 21 months
  • Racing Exp 24
  • Labrador 18%
  • 5 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 1
5 races    Best Time15.12 sec
No rank  Racing *** Coins
60.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAACACCATCACTACTAAGACCATTAGAAAGA
G
C
A
A
C
A
C
C
A
T
C
A
C
T
A
C
T
A
A
G
A
C
C
A
T
T
A
G
A
A
A
G
A
Genes: 6457DD85F28

Composition

Labrador
18%
Beagle
18%
Golder Retriever
18%
Labrador BK
9%
Husky
9%
German Shepard
9%
Yorkshire Terrier
9%
Pug
9%

Current Energy

Vitality -13 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Labrador
Front Legs German Shepard
Head Beagle
Ears Beagle
Snout Golder Retriever
Mouth Labrador
Nose Yorkshire Terrier
Eyes Pug
Color Golder Retriever