Sunday Star Bitcoin Game Dog - Mix of Golder Retriever, German Shepard, Labrador BK, Husky, Schnauzer, French Bulldog, Grey Wolf and Yorkshire Terrier
Sunday Star
  • Purity 9%
  • Age 13 months
  • Racing Exp 18
  • Golder Retriever 27%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 5 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
TOP 10 Fastest

Bio

I'm having some new data architecture built for me, then I'd like to have you over to my place. Halloween costumes are the worst, I hate 'em! I'm into recreational spankings and a little 'ruff' play. I've been solitary dog...looking for someone worth changing over.

Racing Stats

Ran 5 races
  • 1 1 0
 Best Time14.37 sec
Rank 2  RacingĀ *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAACAAGATCATCAATACGACCCTTAAGAAGA
G
C
A
A
C
A
A
G
A
T
C
A
T
C
A
A
T
A
C
G
A
C
C
C
T
T
A
A
G
A
A
G
A
Genes: 64877C9LF88

Composition

Golder Retriever
27%
German Shepard
18%
Labrador BK
9%
Husky
9%
Schnauzer
9%
French Bulldog
9%
Grey Wolf
9%
Yorkshire Terrier
9%

Current Energy

Vitality -5 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Golder Retriever
Front Legs German Shepard
Head German Shepard
Ears Schnauzer
Snout French Bulldog
Mouth Grey Wolf
Nose Yorkshire Terrier
Eyes Golder Retriever
Color Golder Retriever