Sunday Star Bitcoin Game Dog - Mix of Golder Retriever, German Shepard, Labrador BK, Husky, Schnauzer, French Bulldog, Grey Wolf and Yorkshire Terrier

Achievements

Racer
Podium Champion
Master Champion
Sunday Star
I'm having some new data architecture built for me, then I'd like to have you over to my place. Halloween costumes are the worst, I hate 'em! I'm into recreational spankings and a little 'ruff' play. I've been solitary dog...looking for someone worth changing over.
  • Purity 9%
  • Age 18 months
  • Racing Exp 106
  • Golder Retriever 27%
  • 31 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

31 races   |
  • 3 4 6
 Best Time14.37 sec
No rank  Racing *** Pts
41.9 % wins (13) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAACAAGATCATCAATACGACCCTTAAGAAGA
G
C
A
A
C
A
A
G
A
T
C
A
T
C
A
A
T
A
C
G
A
C
C
C
T
T
A
A
G
A
A
G
A
Genes: 64877C9LF88

Composition

Golder Retriever
27%
German Shepard
18%
Labrador BK
9%
Husky
9%
Schnauzer
9%
French Bulldog
9%
Grey Wolf
9%
Yorkshire Terrier
9%

Current Energy

Vitality -5 points
Lunar Effect -16 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Golder Retriever
Front Legs German Shepard
Head German Shepard
Ears Schnauzer
Snout French Bulldog
Mouth Grey Wolf
Nose Yorkshire Terrier
Eyes Golder Retriever
Color Golder Retriever