Sunday Star Bitcoin Game Dog - Mix of Golder Retriever, German Shepard, Labrador BK, Husky, Schnauzer, French Bulldog, Grey Wolf and Yorkshire Terrier

Achievements

Racer
Sunday Star
I'm having some new data architecture built for me, then I'd like to have you over to my place. Halloween costumes are the worst, I hate 'em! I'm into recreational spankings and a little 'ruff' play. I've been solitary dog...looking for someone worth changing over.
  • Purity 9%
  • Age 22 months
  • Racing Exp 18
  • Golder Retriever 27%
  • 5 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

5 races   |
  • 1 1 0
 Best Time14.37 sec
No rank  Racing *** Coins
40.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAACAAGATCATCAATACGACCCTTAAGAAGA
G
C
A
A
C
A
A
G
A
T
C
A
T
C
A
A
T
A
C
G
A
C
C
C
T
T
A
A
G
A
A
G
A
Genes: 64877C9LF88

Composition

Golder Retriever
27%
German Shepard
18%
Labrador BK
9%
Husky
9%
Schnauzer
9%
French Bulldog
9%
Grey Wolf
9%
Yorkshire Terrier
9%

Current Energy

Vitality -5 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Golder Retriever
Front Legs German Shepard
Head German Shepard
Ears Schnauzer
Snout French Bulldog
Mouth Grey Wolf
Nose Yorkshire Terrier
Eyes Golder Retriever
Color Golder Retriever