Nina Nicky Bitcoin Dog - Mix of Golder Retriever, Labrador BK, Poodle, German Shepard, Schnauzer, French Bulldog, Border Collie and Yorkshire Terrier

Achievements

Racer
Nina Nicky
A-yo...Call me Nina Nicky. I make the best virtual pet. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I pee when I'm excited. I don't like it when my bowl is empty, so I take it to my human and it magically refills!
  • Purity 12%
  • Age 22 months
  • Racing Exp 23
  • Golder Retriever 36%
  • 7 races
  • Gen 7
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 0 1 2
 Best Time15.98 sec
No rank  Racing *** Coins
42.9 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGACAGAAGATCAATACGATACTTAAGAAGA
G
C
A
G
A
C
A
G
A
A
G
A
T
C
A
A
T
A
C
G
A
T
A
C
T
T
A
A
G
A
A
G
A
Genes: 6I887C9JF88

Composition

Golder Retriever
36%
Labrador BK
9%
Poodle
9%
German Shepard
9%
Schnauzer
9%
French Bulldog
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -10 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Poodle
Legs Golder Retriever
Front Legs Golder Retriever
Head German Shepard
Ears Schnauzer
Snout French Bulldog
Mouth Border Collie
Nose Yorkshire Terrier
Eyes Golder Retriever
Color Golder Retriever