Nina Nicky Bitcoin Dog - Mix of Golder Retriever, Labrador BK, Poodle, German Shepard, Schnauzer, French Bulldog, Border Collie and Yorkshire Terrier
Nina Nicky
  • Purity 12%
  • Age 51 months
  • Racing Exp 63
  • Golder Retriever 36%
  • Gold medal 1 Silver medal 4 Bronze medal 3
  • 17 races
  • Gen 7
Sad & Snaillike

Achievements

Podium Champion
Pro Racer

Bio

A-yo...Call me Nina Nicky. I make the best virtual pet. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I pee when I'm excited. I don't like it when my bowl is empty, so I take it to my human and it magically refills!

Racing Stats

Ran 17 races
  • 1 4 3
 Best Time15.98 sec
Rank 52  RacingĀ *** Pts
47.1% wins (8) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAGACAGAAGATCAATACGATACTTAAGAAGA
G
C
A
G
A
C
A
G
A
A
G
A
T
C
A
A
T
A
C
G
A
T
A
C
T
T
A
A
G
A
A
G
A
Genes: 6I887C9JF88

Composition

Golder Retriever
36%
Labrador BK
9%
Poodle
9%
German Shepard
9%
Schnauzer
9%
French Bulldog
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -10 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Poodle
Legs Golder Retriever
Front Legs Golder Retriever
Head German Shepard
Ears Schnauzer
Snout French Bulldog
Mouth Border Collie
Nose Yorkshire Terrier
Eyes Golder Retriever
Color Golder Retriever

Parents

No Children

Photos

Litecoin dog racing photo online dog race results Bitcoin dog race results Bitcoin pet racing results online pet race podium Litecoin doggy race online dog racing podium crypto pet race
Gift