Shibe Snoopy Digital Cryptocurrency Game Dog - Mix of Golder Retriever, Border Collie and Poodle

Achievements

Racer
Shibe Snoopy
The cloud's my neighborhood. I'm not into dog collars, unless you're into S & M. My humans say I slobber too much, but hey, I'm just juicy. Steak is my absolute favorite, but I prefer to eat chicken for my health. I'm looking for a good Tug-O-War partner.
  • Purity 51%
  • Age 38 months
  • Racing Exp 4
  • Golder Retriever 73%
  • 4 races
  • Gen 6
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 0 0
 Best Time16.03 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAGACAGAAGATACAGAAGATACAGAAGAAGA
A
G
A
G
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
A
G
A
Genes: 8I88J88J888

Composition

Golder Retriever
73%
Border Collie
18%
Poodle
9%

Current Energy

Vitality -5 points
Lunar Effect -22 points

Traits Breakdown

Body Golder Retriever
Tail Poodle
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever