Lou Lady Rover Litecoin Game Dog - Mix of Golder Retriever and Grey Wolf

Achievements

None
Lou Lady Rover
My name is Lou Lady Rover and I'd really like to sniff you. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I am not above stealing food off humans' plates. Shy dogs that tuck tail bore me.
  • Purity 82%
  • Age 38 months
  • Racing Exp 0
  • Golder Retriever 91%
  • 0 races
  • Gen 7
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAAGAAGAAGACCCAGAAGAAGAAGAAGAAGA
A
G
A
A
G
A
A
G
A
A
G
A
C
C
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
Genes: 8888L888888

Composition

Golder Retriever
91%
Grey Wolf
9%

Current Energy

Vitality -22 points
Lunar Effect -26 points

Traits Breakdown

Body Golder Retriever
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Grey Wolf
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever