Cletus Czar Litecoin Dog - Mix of Golder Retriever, Shiba Inu, Schnauzer, Grey Wolf, Beagle, Corgi, Dachshund, Border Collie and Yorkshire Terrier

Achievements

None
Cletus Czar
Too much steak gives me the runs! I hate being left alone all day. I love car rides when I can stick my head out the window. When I can break free, I enjoy exploring my neighborhood without my human.
  • Purity 5%
  • Age 41 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATAAGAGTAGTACCCCTAAGCAGAGGATACTTA
A
T
A
A
G
A
G
T
A
G
T
A
C
C
C
C
T
A
A
G
C
A
G
A
G
G
A
T
A
C
T
T
A
Genes: C8EELDO8AJF

Composition

Golder Retriever
18%
Shiba Inu
18%
Schnauzer
9%
Grey Wolf
9%
Beagle
9%
Corgi
9%
Dachshund
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -43 points
Lunar Effect +6 points

Traits Breakdown

Body Schnauzer
Tail Golder Retriever
Legs Shiba Inu
Front Legs Shiba Inu
Head Grey Wolf
Ears Beagle
Snout Corgi
Mouth Golder Retriever
Nose Dachshund
Eyes Border Collie
Color Yorkshire Terrier